Skip to content

ViennaRNA/forna

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

512 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

RNA Secondary Structure Visualization Using a Force Directed Graph Layout

forna logo

Overview

The forna package provides a web interface for displaying RNA secondary structures using the force-directed graph layout provided by the d3.js visualization library.

The front end makes use of Bootstrap and Knockout.js for the user interfact while the back end uses Flask to serve the static files and provide a REST API. The RNA structure manipulation and graph construction is created using the python forgi RNA structure manipulation library and the provided forna.py script. We heavily depend on the python bindings of the ViennaRNA package.

Developer Documentation

Runing Locally

The server can be run locally on your machine. It depends on the forgi library and needs the ViennaRNA package installed with python bindings enabled (./configure --with-python). Further, you need to downlaod the MC-Annotate program and make it executeable by the server script. To run it use the following command:

python forna_server.py -s -d

Documentation about the available options is provided using the -h option.

APIs

We provide the opportunity to add an RNA molecule from supported platforms using URL encoded queries. At the moment the ViennaRNA webservices and the RNAcentral database are supported as well as URL encoded data. Please contact us if you have suggestions for additional platforms.

To add a molecule using the RNAcentral-ID you can just call forna like this: forna-domain/?id=RNAcentral/RNAcentral-ID eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=RNAcentral/URS0000000001

To include the data directly in the URL, two formats are available: forna-domain/?id=fasta&file=fasta-file eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=fasta&file=>header\nAACGUUAGUU\n(((....))) forna-domain/?id=url/molecule-name&sequence=sequence&structure=structure eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=url/name&sequence=AACGUUAGUU&structure=(((....))) In the first case it's possible to input multiple molecules at once by having them all in a single string which is passed to the 'file' query. Note that in both cases the structure is optional. If it's not provided, RNAfold will calculate and display the MFE structure.

For any platform it is also optionally possible to append a colors query using the custom color format: forna-domain/?id=fasta&file=fasta-file&colors=custom-color-format eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=fasta&file=>header\nAACGUUAGUU\n(((....)))&colors=>header\nrange%3Dwhite:red\n0\n0.1\n0.2\n0.3\n0.4\n0.5\n0.6\n0.7\n0.8\n0.9\n1

Notice that the range part of the color parameter uses %3D to denote the '='. This is to prevent it from being interpreted as its own argument.

This way it's also possible to embed forna on a website with a preloaded molecule.

<iframe src="forna/index.html?id=RNAcentral/URS0000000001" align="center" height="650px" width="100%" 
seamless='seamless' frameBorder="0" AllowFullScreen></iframe>

Using Forna as a Javascript Visualization Container

In many situations, the user interaction is superfluous and the desired goal is to simply display a secondary structure on a web page. This is a common scenario in, for example, servers that predict a secondary structure. The output, a dot-bracket string can simply be added to a FornaContainer object to display.

While the specifics are detailed in the online documentation, the general pattern for use is shown in the example web page below:

<!DOCTYPE html>
<meta charset="utf-8">
<link rel="stylesheet" type="text/css" href="fornac.css" media="screen" />

This is an RNA container.
<div id='rna_ss'> </div>
This is after the RNA container.

    <script type='text/javascript' src='jquery.js'></script>
    <script type='text/javascript' src='d3.js'></script>
    <script type='text/javascript' src='fornac.js'></script>

    <script type='text/javascript'>
        var container = new FornaContainer("#rna_ss", {'applyForce': false});

        var options = {'structure': '((..((....)).(((....))).))',
                       'sequence':             'CGCUUCAUAUAAUCCUAAUGACCUAU'};

        container.addRNA(options.structure, options);
    </script>

The two key features are the creation of a div to contain the forna container and the javascript at the bottom which populates it with an RNA sequence, secondary structure and some optional parameters. The resulting web page can be seen in the screenshot below where a visualization of the RNA secondary structure appears without the need to first create a static image or call a java library.

fornac example

Contact

Questions and/or comments can be sent to forna@tbi.univie.ac.at

Acknowledgement

This work was funded by the Austrian DK RNA program FG748004, by the Austrian FWF, project "SFB F43 RNA regulation of the transcriptome," and the European Commission under the Environment Theme of the 7th Framework Program for Research and Technological Development (Grant agreement no: 323987).

About

Create force-directed graphs of RNA secondary structures.

Resources

License

Stars

113 stars

Watchers

7 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors